jueves, 10 de mayo de 2018

3. 9-1 SINTESIS DE PROTEINAS

       


Tema: SINTESIS DE PROTEINAS
La síntesis de proteínas es el proceso mediante el cual los ribosomas  de la célula fabrican las proteínas con ayuda de las moléculas de ADN y ARN.  Las proteínas  son macromoléculas orgánicas constituidas por cadenas lineales de aminoácidos que llevan C, H, O y N en su composición. Algunas de estas sustancias orgánicas llevan S y P y en menores proporciones Mg, Fe y otros elementos. Las proteínas son los compuestos orgánicos más importantes de los seres vivos, puesto que tienen acciones fundamentales en el organismo; están formadas  por unidades sencillas llamadas Aminoácidos. La síntesis de proteínas se resume en dos pasos:
1. LA TRANSCRIPCIÓN. Es el proceso mediante el cual se construye  una molecula de ARNm a partir de una milecula de ADN. en este proceso actúan enzimas, que son unas clase de proteinas importante para las reacciones quimicas.
2. LA TRADUCCION.  Es el procesos mediante el cual la información genetica que porta la molecula de ARNm recien constituida, es utilizada para la construcción de  proteinas,  mediante sucesivas adiciones de aminoacidos. Para que esto suceda el ARNr se encarga de buscar los aminoacidos apropiados a cada codon o tripleta del ARNm ejemplo el codón formado por las bases GCC corresponde al aminoacido Leucina; mientras que el formado por CAG corresponde  al aminoacido Valina.



   LOS AMINOACIDOS         
Los aminoácidos son compuestos químicos formados por un grupo amino y un grupo carboxilo.

 Cuando dos aminoácidos se combinan se obtiene un dipéptido;                                       tres aminoácidos un tripéptido;                                                                                                                                                                                                           y mayor cantidad de uniones de aminoácidos forman polipéptidos.                                      Cuando el polipéptido consta de más de medio centenar de aminoácidos se denomina proteína.
Los aminoácidos necesarios para la formación de proteínas están en el citoplasma de las células. Esas uniones se codifican en el núcleo celular.
Los aminoácidos son las unidades químicas o "bloques de construcción" del cuerpo que forman las proteínas. Las sustancias proteicas construidas gracias a estos 20 aminoácidos forman los músculos, tendones, órganos, glándulas, las uñas y el pelo. etc. Estos son: Serina (Ser), Treonina (Thr), Cisteína (Cys), Asparagina (Asn), Glutamina (Gln ) Tirosina (Tyr), Glicina (Gly), Alanina (Ala), Valina (Val), Leucina (Leu), Isoleucina (Ile), Metionina (Met)), Prolina (Pro), Fenilalanina (Phe) y Triptófano (Trp), Ácido aspártico (Asp,)  Ácido glutámico (Glu), Lisina (Lys), Arginina (Arg) e Histidina (His).
Existen dos tipos principales de aminoácidos que están agrupados según su procedencia y características. Estos grupos son aminoácidos esenciales y aminoácidos no esenciales.
Los aminoácidos que se obtienen de los alimentos se llaman "Aminoácidos esenciales". Tienen que ser incorporados con la dieta porque el organismo no los sintetiza
Los aminoácidos que puede fabricar nuestro organismo a partir de otras fuentes, se llaman "Aminoácidos no esenciales".
El crecimiento, la reparación y el mantenimiento de todas las células dependen de ellos. Después del agua, las proteínas constituyen la mayor parte del peso de nuestro cuerpo
  

ACTIVIDAD  N°   
1. Cuantos codones  hay en la siguiente secuencia de ARNm AUGCUAAAAGGGUUC
2. Escribir la secuencia de la molécula de ARNm sintetizada a partir de una cadena de ADN molde que presente la siguiente secuencia:   3' T-A-C-G-T-A-C-C-G-T-A-T-C-A-T-A-T-C 5' 
3. Un fragmento de la cadena de ADN que codifica la oxitocina tiene la siguiente secuencia de bases:
DNA
 3'TTAGCAGTATATTTGATTACACGGTAGCCCCAT5'. 
 Determina la secuencia de bases del ARNm.
 ARNm
          Escribe la cadena polipeptidica que se origina 
 polipeptido


4. Dada la siguiente secuencia de ADN:
T-A-G-G-G-A-T-C-A-T-A-A-T-A-C
Escribe el ARN m correspondiente a la cadena complementaria:

Escribe la cadena polipeptídica que se origina:


5.Con ayuda de la tabla del código genético, prediga la secuencia de aminoácidos que se produce durante la traducción de la siguiente cadena de ARNm:
ARNm
AUG- CCG- GAU- UUA- AGU- UGA
aminoácido



6. Con ayuda de la tabla del código genético, prediga la secuencia de aminoácidos que se produce durante la traducción de la siguiente cadena de ARNm: 
ARNm
AUG- AGA- GAU- UUA- AGU- UAA 
aminoácidos



7. 1. A partir de la siguiente cadena molde de ADN: , los codones del ARNm son: 
ADN
CTT TTT TGC CAT ACA TCA ATA
ARNm


Escribe la complementaria de la siguiente cadena de ADN
ADN:
A
A
T
G
G
C
G
T
T
T
A
T
C
C
G
T
G
C
C
C
T
G
C
T
T
C
C
T
T
C
G
T
G
T
T
A
G
G
T
G

 DNAc


La cadena de ARNm que se obtiene del ADNc  es
 ARNm


La cadena de aminoácidos que se obtiene al traducir ese ARNm:
 Codones

 Aminoacidos



COMPLETE LOS ESPACIOS EN BLANCOS
Cómo sería la cadena de ADN complementaria a la definida por la secuencia AGTTCA__________________
El proceso de la síntesis de proteínas también se denomina: ______________________________________
La información genética está almacenada en:__________________________________________________
Cómo se organizan los genes dentro de los cromosomas________________________________________

El dogma central de la Biología molecular puede resumirse en la siguiente ecuación:___________________
Cuántas "palabras" o tripletas encontramos en el código genético?_________________________________
Tenemos un trozo de molécula de ARN mensajero con esta secuencia: - AGC-CCA-UGC-CCC-. Debes averiguar la cadena de aminoácidos que codifica_________________________________________________









No hay comentarios:

Publicar un comentario

2. 9-1 TEMA: CODIGO GENETICO

  Area: Ciencias Naturales                                               Asignatura:  Biología   Grado : 9-1 CODIGO GENETICO             ...